Community Action Needed: Please respond to the NIH RFI
Genomic Feature

ihb318

ID
ZDB-ALT-181129-13
Name
ihb318
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Yonghua Sun Lab
Current Source
Other Pages
Note
17bp deleted, 17bp of "CTGGAGTCTGTCGGCCC" deletion from position 633bp exon1 of wild-type cyp11a2 coding sequence.
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 25: 22296698 - 22296714 (GRCz11) (1) Details
Nucleotide change
CTGGAGTCTGTCGGCCC/-
Variant Notes
17bp deleted, 17bp of "CTGGAGTCTGTCGGCCC" deletion from position 633bp exon1 of  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
17 bp deleted at position 633 in Exon 1 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
AAGGGCATCCGCTGCGTAAAAACTTGCTGGATAAGTTGGCGGTTCGTTCCGCTGTGGCGACCCCGGATTAATAAAGGGACTAAGCCGACAAGAAAATGAATAATGCCAGTATATATATATATGTGTGTGTGTATAGCAAAAATGTTATAAAATTTACTATTACTATTTGACTATTTTAATTTTTAGATGTTTAAAAAATCCTTTTTTAATTAATACATCACAAAGAATGTTTAGTCAATGTGGTTTTCCCATGATGACCTATTTGTGAATGAATTATTCTATTTAATTGATTTTTCTTAGTCATTTGTGTTGGCAACTTCCTGCATTTTTGTATCCATTCCACTGTATAGTGTGTGTGTTTAGAAATATGGGTAGGTCCTATTGCACTTGTCTTCAGTGCTTCATTGCCCTTGACACGTACAGTGATCTGGCATATAAAAACAAAAGTCTTCTTTCAGTGGGTCTGCTAGAGGCAGAGACAGAGAGAGTGCAATGGCCCG
CTGGAGTCTGTCGGCCC/- GTCTGGATCAGTCTGTGTCTTCACTGAAACACCTGCTGCAGGTCATAGTCACTCGCTCAGGCCGAGCACCTGCAATCGGACTGCAAGACTCCACTGTACGGCCATTCAATGAGATCCCTGGACAATGGAGGAACAGCCTGAAAAGTGTCTTTGCCTTCGCCAAAATGGGTGGCCTCAGGAATATCCACCGGATTATGGTGCACAATTTTAATACATTTGGTCCGATTTACAGGTAAACAAGACACTTTAAAAACTTTTTTTTTAAGTAATCTTTTTATTTTATTAAAATCAAGAACAAGTATTGTGTATCTCCAGTTTGTCTGCTCGAGGACTGCTTCAAAACTGTTTAACTGGGATATTCTATGACCTTTTCACTTTTATTTAGCTTCTGTCGCAACTTTTCTGAAACTTTTTGCAGTGAAATTTTAAACTTGTTCATATTTACAAAATGTGTTTACATTTGAGAGTGAAAATGGTGGAAACATTGTCTCTGGACTTTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations