header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-181129-13
Genomic Feature: ihb318
Synonyms:
Affected Genomic Regions: cyp11a2 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-cyp11a2
Lab Of Origin: Yonghua Sun Lab
Location: Chr 25: 22296698 - 22296714 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 17 bp deleted at position 633 in Exon 1 (1)
FLANKING SEQUENCE (GENOMIC)
AAGGGCATCCGCTGCGTAAAAACTTGCTGGATAAGTTGGCGGTTCGTTCCGCTGTGGCGACCCCGGATTAATAAAGGGACTAAGCCGACAAGAAAATGAATAATGCCAGTATATATATATATGTGTGTGTGTATAGCAAAAATGTTATAAAATTTACTATTACTATTTGACTATTTTAATTTTTAGATGTTTAAAAAATCCTTTTTTAATTAATACATCACAAAGAATGTTTAGTCAATGTGGTTTTCCCATGATGACCTATTTGTGAATGAATTATTCTATTTAATTGATTTTTCTTAGTCATTTGTGTTGGCAACTTCCTGCATTTTTGTATCCATTCCACTGTATAGTGTGTGTGTTTAGAAATATGGGTAGGTCCTATTGCACTTGTCTTCAGTGCTTCATTGCCCTTGACACGTACAGTGATCTGGCATATAAAAACAAAAGTCTTCTTTCAGTGGGTCTGCTAGAGGCAGAGACAGAGAGAGTGCAATGGCCCG
CTGGAGTCTGTCGGCCC/-
GTCTGGATCAGTCTGTGTCTTCACTGAAACACCTGCTGCAGGTCATAGTCACTCGCTCAGGCCGAGCACCTGCAATCGGACTGCAAGACTCCACTGTACGGCCATTCAATGAGATCCCTGGACAATGGAGGAACAGCCTGAAAAGTGTCTTTGCCTTCGCCAAAATGGGTGGCCTCAGGAATATCCACCGGATTATGGTGCACAATTTTAATACATTTGGTCCGATTTACAGGTAAACAAGACACTTTAAAAACTTTTTTTTTAAGTAATCTTTTTATTTTATTAAAATCAAGAACAAGTATTGTGTATCTCCAGTTTGTCTGCTCGAGGACTGCTTCAAAACTGTTTAACTGGGATATTCTATGACCTTTTCACTTTTATTTAGCTTCTGTCGCAACTTTTCTGAAACTTTTTGCAGTGAAATTTTAAACTTGTTCATATTTACAAAATGTGTTTACATTTGAGAGTGAAAATGGTGGAAACATTGTCTCTGGACTTTT
NOTES
Comment Citation
17bp deleted, 17bp of "CTGGAGTCTGTCGGCCC" deletion from position 633bp exon1 of  ... Zebrafish Nomenclature Committee
OTHER ihb318 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (2)