Community Action Needed: Please respond to the NIH RFI
Genomic Feature

ihb316

ID
ZDB-ALT-181129-11
Name
ihb316
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Yonghua Sun Lab
Current Source
Other Pages
Note
10bp deleted, 10bp of "ACGATCTGGG" deletion from position 936bp exon1 of wild-type tcf7l2 coding sequence.
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 12: 31102961 - 31102970 (GRCz11) (1) Details
Nucleotide change
ACGATCTGGG/-
Variant Notes
10bp deleted, 10bp of "ACGATCTGGG" deletion from position 936bp exon1 of  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
10 bp deleted at position 936 in Exon 1 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
AAACTTTTAGTTTAAGTTACATTCCCAAAAAACTTTGTAAGTTACGTATGTGCAGAAGCAAAGTGAAACCGATGCACCGTGTTGTTGTCCTGTGCAAAAACAAAAAGAAGGAGATTTAGAGAAAAGAAGCACTCACCCTCCTCTAAACTTTCTCTTGTTTTGTCTCTGAAACTTTCAGATCTAGGCGGAGGCCGTCTTTCCGCCTTGAAATGCAACGAAACACAGGGAATGCATTGAATAATCACAGCGAGGAGATCGTTACGTTAGCTAGTTAGCAGCGTGTTTAAGCAGGAAAAAGTGCATGTAAACTTGTGGACAAGTCGCGGATTCGCGCTTATTTGTCACTTACCTCGGAATCCGAAGAGCTGTTTTGATTCGTTTCCGACTCGTTTACGAGAGAAGACTTGACATCTGCTAAATCCCTTTCTGCTGAGGAGTTCTCCGAAATCTTTTCCTCCTGCTCGCCTTCGTCTTTGAAGGAAATCATTTCATCGTTCGCA
ACGATCTGGG/- CCCCTCCACCACCGTTCAGCTGCGGCATTTTTCCCGAGGAGCGCTAATTTTGCGGGGGGCCAAAAACACCCAAAAGTTTTTAAACCCTTGATCTTGGTGTGATCCCCGAATCCCGAGTTTTAAGTTTAGGGACTCGCAGTGGCGTTTGGCTGGGTGAGTGTTCAAAACTCAAAAAGAAGAGGGCAATCTTGGCAGAAACAGAAGCCGGAGACGGAGCTGAGGCGCTCGGATTGAGGGAGTTGAAGTTGGTCGGAGTGGTTTTCAGTTCAAAGGCGGCGCTGATTGACAGATAGAGAGGGATGGAAATAGAGAGAGTCTGGATTCGGGATTATTGACAGGGAGAAACACACAAGAAAAAAAATCTAATGAGATTCAAACAGGGAGGGACTTGAAGTGACGTTTTCATAAATAGAGAGGGGCAGGAAAAAGTACTGGAGGGGGAAAAGGGCTTGAACGAGAGAGAGAGAGTGAGTGAGTGAGCGAGCGAGCGAGAGAGAGAG
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations