header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-181129-11
Genomic Feature: ihb316
Synonyms:
Affected Genomic Regions: tcf7l2 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR2-tcf7l2
Lab Of Origin: Yonghua Sun Lab
Location: Chr 12: 31102961 - 31102970 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 10 bp deleted at position 936 in Exon 1 (1)
FLANKING SEQUENCE (GENOMIC)
AAACTTTTAGTTTAAGTTACATTCCCAAAAAACTTTGTAAGTTACGTATGTGCAGAAGCAAAGTGAAACCGATGCACCGTGTTGTTGTCCTGTGCAAAAACAAAAAGAAGGAGATTTAGAGAAAAGAAGCACTCACCCTCCTCTAAACTTTCTCTTGTTTTGTCTCTGAAACTTTCAGATCTAGGCGGAGGCCGTCTTTCCGCCTTGAAATGCAACGAAACACAGGGAATGCATTGAATAATCACAGCGAGGAGATCGTTACGTTAGCTAGTTAGCAGCGTGTTTAAGCAGGAAAAAGTGCATGTAAACTTGTGGACAAGTCGCGGATTCGCGCTTATTTGTCACTTACCTCGGAATCCGAAGAGCTGTTTTGATTCGTTTCCGACTCGTTTACGAGAGAAGACTTGACATCTGCTAAATCCCTTTCTGCTGAGGAGTTCTCCGAAATCTTTTCCTCCTGCTCGCCTTCGTCTTTGAAGGAAATCATTTCATCGTTCGCA
ACGATCTGGG/-
CCCCTCCACCACCGTTCAGCTGCGGCATTTTTCCCGAGGAGCGCTAATTTTGCGGGGGGCCAAAAACACCCAAAAGTTTTTAAACCCTTGATCTTGGTGTGATCCCCGAATCCCGAGTTTTAAGTTTAGGGACTCGCAGTGGCGTTTGGCTGGGTGAGTGTTCAAAACTCAAAAAGAAGAGGGCAATCTTGGCAGAAACAGAAGCCGGAGACGGAGCTGAGGCGCTCGGATTGAGGGAGTTGAAGTTGGTCGGAGTGGTTTTCAGTTCAAAGGCGGCGCTGATTGACAGATAGAGAGGGATGGAAATAGAGAGAGTCTGGATTCGGGATTATTGACAGGGAGAAACACACAAGAAAAAAAATCTAATGAGATTCAAACAGGGAGGGACTTGAAGTGACGTTTTCATAAATAGAGAGGGGCAGGAAAAAGTACTGGAGGGGGAAAAGGGCTTGAACGAGAGAGAGAGAGTGAGTGAGTGAGCGAGCGAGCGAGAGAGAGAG
NOTES
Comment Citation
10bp deleted, 10bp of "ACGATCTGGG" deletion from position 936bp exon1 of  ... Zebrafish Nomenclature Committee
OTHER ihb316 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (2)