header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-181129-10
Genomic Feature: ihb315
Synonyms:
Affected Genomic Regions: tcf7l1b (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-tcf7l1b
Lab Of Origin: Yonghua Sun Lab
Location: Chr 8: 52229432 - 52229442 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 11 bp deleted at position 20 in Exon 1 (1)
FLANKING SEQUENCE (GENOMIC)
TTGTCTTAAGTTCAATCTACTTAGATTTGTTAAAACTATTAAGTTTACTTAATGAGTTGTGTTGGGAGAACATAAAGAAATTGTGTGGTACCCATAATTGTTTACAGAATAAAAACAGAGCTAGTTTTTGGGAAATAGTTGTTAAATCGGCATGCCACAGCTCTTACCTTCGGTGAAATACTCTCGGGCTTTCTCGTAACTTTCGAGATCTGCTCTTGGTTGAGGTCGCCTCTCGGTTTGCTGAAGGGAAGACGAAAAACAAAGCAGAAAAGTTATTTTTTCCGTCGGCAAACAACCACATCCATGCGCGTCTGTCGGCATGCGGTTGCGTCTGACTGAACTTACCTCAGAATCGGACGAGCTGCTGTTATTTTCCGACTCATTCACCAGAGACGACTTCACATCGTCCAGATCTCTCTCGGCGGACACGTTTTCGGAGATTTTGTCCTCCTGTTCGCCTTCATCTTTAAATGAGATCATTTCATCGTTGGCCCCGAGCT
CGTCCCCTCCG/-
CCTCCGTTAAGCTGCGGCATGTTTAACGTTACGGGCTTGTCTTGCAAACGGTCACAAAATCTAGAGTTTGTGTCGACTCTGAAGTGCACGGAAAACAGCGCAGTCCACTCAATGCGGGAATAAAACGTTCAGAAATAATCCTTGACGCATGTATTTAAATCCAGGTTGTCCATGTTTACCTTCGAGAAACGATCACACGGTATCCTTGTCGTAAACTCTGCAAACTCCCAGCAACCGCCGTGTCCTCGCTCGTTACTGCTTGCCGTCAAACTTACCAAACACGATTAAAAGTACTCGAAACAACTGTTGATTCTGTAATCCACAAAGCTAAAAGTTGATTATTGTTTTTCTTTTGAAAAACACGCACCCGTCAGTAGCATAGCGTGAACGCGCGTGCTTGATTGCAACAAAAGTTGTAACAACGGTCGCGGCGGCTCCGTAGTCTCTATCCCACAGACGTGTTTTAGTCAGATAAAACACAGATTCCTCCCGAATCAGCT
NOTES
Comment Citation
11bp deleted, 11bp of "CGGAGGGGACG" deletion from position 20bp exon1 of  ... Zebrafish Nomenclature Committee
OTHER ihb315 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (2)