Community Action Needed: Please respond to the NIH RFI
Genomic Feature

ihb315

ID
ZDB-ALT-181129-10
Name
ihb315
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Yonghua Sun Lab
Current Source
Other Pages
Note
11bp deleted, 11bp of "CGGAGGGGACG" deletion from position 20bp exon1 of wild-type tcf7l1b coding sequence.
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 8: 52229432 - 52229442 (GRCz11) (1) Details
Nucleotide change
CGTCCCCTCCG/-
Variant Notes
11bp deleted, 11bp of "CGGAGGGGACG" deletion from position 20bp exon1 of  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
11 bp deleted at position 20 in Exon 1 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
TTGTCTTAAGTTCAATCTACTTAGATTTGTTAAAACTATTAAGTTTACTTAATGAGTTGTGTTGGGAGAACATAAAGAAATTGTGTGGTACCCATAATTGTTTACAGAATAAAAACAGAGCTAGTTTTTGGGAAATAGTTGTTAAATCGGCATGCCACAGCTCTTACCTTCGGTGAAATACTCTCGGGCTTTCTCGTAACTTTCGAGATCTGCTCTTGGTTGAGGTCGCCTCTCGGTTTGCTGAAGGGAAGACGAAAAACAAAGCAGAAAAGTTATTTTTTCCGTCGGCAAACAACCACATCCATGCGCGTCTGTCGGCATGCGGTTGCGTCTGACTGAACTTACCTCAGAATCGGACGAGCTGCTGTTATTTTCCGACTCATTCACCAGAGACGACTTCACATCGTCCAGATCTCTCTCGGCGGACACGTTTTCGGAGATTTTGTCCTCCTGTTCGCCTTCATCTTTAAATGAGATCATTTCATCGTTGGCCCCGAGCT
CGTCCCCTCCG/- CCTCCGTTAAGCTGCGGCATGTTTAACGTTACGGGCTTGTCTTGCAAACGGTCACAAAATCTAGAGTTTGTGTCGACTCTGAAGTGCACGGAAAACAGCGCAGTCCACTCAATGCGGGAATAAAACGTTCAGAAATAATCCTTGACGCATGTATTTAAATCCAGGTTGTCCATGTTTACCTTCGAGAAACGATCACACGGTATCCTTGTCGTAAACTCTGCAAACTCCCAGCAACCGCCGTGTCCTCGCTCGTTACTGCTTGCCGTCAAACTTACCAAACACGATTAAAAGTACTCGAAACAACTGTTGATTCTGTAATCCACAAAGCTAAAAGTTGATTATTGTTTTTCTTTTGAAAAACACGCACCCGTCAGTAGCATAGCGTGAACGCGCGTGCTTGATTGCAACAAAAGTTGTAACAACGGTCGCGGCGGCTCCGTAGTCTCTATCCCACAGACGTGTTTTAGTCAGATAAAACACAGATTCCTCCCGAATCAGCT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations