ZFIN ID: ZDB-ALT-181106-12
Genomic Feature: ihb294
Synonyms:
Affected Genomic Regions: hsf1 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR2-hsf1
Lab Of Origin: Yonghua Sun Lab
Location: Chr 19: 3060539 - 3060548 (GRCz11) (1) Details
Sequence:
Current Sources: China Zebrafish Resource Center (CZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 10 bp deleted from position 412 to 421 (1)
FLANKING SEQUENCE (GENOMIC)
GCTTAAACCAGAGCCGCTAAATAAACACATGAGAAGTTGTAAAGTATTGAATTAACACTATCTGTCAGCTGTCTAATTCTGGACTATTATAAGTGGATTTGGCTGTTAGCTGGTGACTTTGTTTTAAGCTGACAGCCCGAAGAGGGACATTTTATTGGTCATTGAGGTAAAGTTGTTACCCATATGGTTTACCATGCTACTTTTAAAAATTGGATCTGAAATAGCATGTTAAGTATGAATTTAAAATAACATTAGCCATATTTAATAAACTGTGAACAGTGTTGTACTTTGATTGTCATTGGCTGCTAATATGATTTCCCTATTAAGAATTTGTAAATAATACTTTTCTGAAATTGTAAAGTCCTAGTGTGTGAATATAAAGCTAACATTGTTTACTAAAACTGTTTGACTGCGTTTTCAGAATGGCACCAGTTTCCACGTCTTCGACCAGGGCAGGTTTTCCAAAGAAGTTCTGCCGAAATACTTCAAGCACAACAACA
TGGCCAGTTT/-
TGTCCGCCAGCTCAATATGTGTAAGTATAAGAGGAATATGATAATGGCTTTAATCTGTTTAATCATTTTAATGACCTAATAAACTTTATTTATAGACTTAGATGGTTAAAGCTGAAGGTGTTGAATAAATGTTTAGGCTCATATAAATGTTAACGTGGAAGATTTTGATTCGTGTTTTGTTGGATAATGTGAACATTTTTGGATGGTGTGTATTTTAAATGAAGCTGCACTAAATAAGTAATTCTATATTGTCCACATTTTCTCCATATTTAGTGTTTCAAGATTTTATGCAATGTAGATATGTTTTATCATAATAATAATATTTTTATTTATATATTTCTTGATATTTAATCCTGATTGTGCACATTGTGTAGCTTAGAAATATAATGTTGTCATAATAATAAAAAGACATTTTATTTACATTTTTTATGATACTAATGCTGCCTCCATATTCTATGACATAATAATCTTAATACTCACACTTTTAATTTATAAAATTT
NOTES
Comment Citation
Ihb294: Between 412 bp to 421 bp of the wild-type hsf1 coding sequence,  ... Zebrafish Nomenclature Committee
OTHER ihb294 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (2)