Community Action Needed: Please respond to the NIH RFI
Genomic Feature

ihb294

ID
ZDB-ALT-181106-12
Name
ihb294
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Yonghua Sun Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Note
Ihb294: Between 412 bp to 421 bp of the wild-type hsf1 coding sequence, TGGCCAGTTT, is deleted. The mutated hsf1 codes for a truncated protein containing 152 aa, 133 aa of which is identical to wildtype hsf1
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 19: 3060539 - 3060548 (GRCz11) (1) Details
Nucleotide change
TGGCCAGTTT/-
Variant Notes
Ihb294: Between 412 bp to 421 bp of the wild-type hsf1 coding sequence,  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
10 bp deleted from position 412 to 421 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
GCTTAAACCAGAGCCGCTAAATAAACACATGAGAAGTTGTAAAGTATTGAATTAACACTATCTGTCAGCTGTCTAATTCTGGACTATTATAAGTGGATTTGGCTGTTAGCTGGTGACTTTGTTTTAAGCTGACAGCCCGAAGAGGGACATTTTATTGGTCATTGAGGTAAAGTTGTTACCCATATGGTTTACCATGCTACTTTTAAAAATTGGATCTGAAATAGCATGTTAAGTATGAATTTAAAATAACATTAGCCATATTTAATAAACTGTGAACAGTGTTGTACTTTGATTGTCATTGGCTGCTAATATGATTTCCCTATTAAGAATTTGTAAATAATACTTTTCTGAAATTGTAAAGTCCTAGTGTGTGAATATAAAGCTAACATTGTTTACTAAAACTGTTTGACTGCGTTTTCAGAATGGCACCAGTTTCCACGTCTTCGACCAGGGCAGGTTTTCCAAAGAAGTTCTGCCGAAATACTTCAAGCACAACAACA
TGGCCAGTTT/- TGTCCGCCAGCTCAATATGTGTAAGTATAAGAGGAATATGATAATGGCTTTAATCTGTTTAATCATTTTAATGACCTAATAAACTTTATTTATAGACTTAGATGGTTAAAGCTGAAGGTGTTGAATAAATGTTTAGGCTCATATAAATGTTAACGTGGAAGATTTTGATTCGTGTTTTGTTGGATAATGTGAACATTTTTGGATGGTGTGTATTTTAAATGAAGCTGCACTAAATAAGTAATTCTATATTGTCCACATTTTCTCCATATTTAGTGTTTCAAGATTTTATGCAATGTAGATATGTTTTATCATAATAATAATATTTTTATTTATATATTTCTTGATATTTAATCCTGATTGTGCACATTGTGTAGCTTAGAAATATAATGTTGTCATAATAATAAAAAGACATTTTATTTACATTTTTTATGATACTAATGCTGCCTCCATATTCTATGACATAATAATCTTAATACTCACACTTTTAATTTATAAAATTT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations