header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-181024-17
Genomic Feature: um300
Synonyms:
Affected Genomic Regions: gbx1 (1)
Type: Insertion (1)
Protocol: embryos treated with CRISPR1-gbx1
Lab Of Origin: Sagerström Lab
Location: Chr 24: 34113860 - 34113886 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 26 bp inserted (1)
FLANKING SEQUENCE (GENOMIC)
AGGGGTGTGTGTATGTGTGTGTTTATGTCTCAGTATGTGACAAATAGAGGCTGAGACAGGGAGAGCTCCAGACAAAAAACGCATCAGGTCTCAGTCAGTTGGACGGCGAGGACCCTACAGCAGCGCCAGGATAACCGTGGACACACATTTGGGTGATTTGAAGGCCAGTACAGCACGGGATTTATACGACCAGACCGCGCTCAGTTCACCATGCAGAGACCGAGCGGTACGGGCACGGCGTTTTCCATTGATTCTTTGATTGGCACTCCACAGCCACGACCGGGCCACCTGCTCTACACGGGCTACCCGATGTTTATGCCGTACCGACCGCTTATGATTCCACAAGCCCTGTCTCATTCGTCATTACCGTCAGGGATCCCACCTTTGGCACCGCTGGCATCTTTCGCAGGGCGTCTGACCAACACTTTTTGCGCGGGGTTAGGACAGGGAATGCCCTCCATGGTGGCGCTCACCACCACCCTGCCTAGTTTCTCGGACCCT
-/ATATTTAATTGCCCNGGAGTTGCCCTGG
AGATGCCGGGACCCCGGTTAGGCGCAGACGGGACGGGGATGAACCGGCAAGAGAGCCCGCATGACGAACTCAAAGGCTCCGAACTCCTCAATTTCACGGAAACTTTTCAAGCAGTTGCAGGTGAGCACCGGAGACCAACTCTCTCGCTGACAGGTGGTTTAATTAGGAGCGCAAACAGTTCAACAGCATTTTCCAAAAAAAGTTCTAATTAGAACTCCAAAGAACTTTAAATAGAACTCAAAAGAATGTTTTACAGTCTCAAAGTTCCACAACAAACTTTTATTCTGTAATTGTTTTAGGTAGGCTAACTGGTTTACTGGTGAGTTAGATAGCTAATAAAGTAATTTGTAACCTGAATATAACTTTTTACATCAAAACCCAAAAGTAAAGTGTTTTAAATTAAATAATAATTTCTCAAAAAGAAATACAAATCGTATAAACTTAAAAAATAAAAACGTTATAGGACTAGGCCTACAATATGGGTTAAATAAAAGTTAAAAG
OTHER um300 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous gbx1um300/um300 gbx1 ♀+/- ♂+/-

CITATIONS  (1)