ZFIN ID: ZDB-ALT-181009-1
Genomic Feature: ihb286
Synonyms:
Affected Genomic Regions: hsf1 (1)
Type: Indel (1)
Protocol: embryos treated with CRISPR2-hsf1
Lab Of Origin: Yonghua Sun Lab
Location: Chr 19: 3060540 - 3060547 (GRCz11) (1) Details
Sequence:
Current Sources: China Zebrafish Resource Center (CZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 1 bp inserted / 8 bp deleted from position 413 to 420 (1)
FLANKING SEQUENCE (GENOMIC)
CTTAAACCAGAGCCGCTAAATAAACACATGAGAAGTTGTAAAGTATTGAATTAACACTATCTGTCAGCTGTCTAATTCTGGACTATTATAAGTGGATTTGGCTGTTAGCTGGTGACTTTGTTTTAAGCTGACAGCCCGAAGAGGGACATTTTATTGGTCATTGAGGTAAAGTTGTTACCCATATGGTTTACCATGCTACTTTTAAAAATTGGATCTGAAATAGCATGTTAAGTATGAATTTAAAATAACATTAGCCATATTTAATAAACTGTGAACAGTGTTGTACTTTGATTGTCATTGGCTGCTAATATGATTTCCCTATTAAGAATTTGTAAATAATACTTTTCTGAAATTGTAAAGTCCTAGTGTGTGAATATAAAGCTAACATTGTTTACTAAAACTGTTTGACTGCGTTTTCAGAATGGCACCAGTTTCCACGTCTTCGACCAGGGCAGGTTTTCCAAAGAAGTTCTGCCGAAATACTTCAAGCACAACAACAT
GGCCAGTT/A
TTGTCCGCCAGCTCAATATGTGTAAGTATAAGAGGAATATGATAATGGCTTTAATCTGTTTAATCATTTTAATGACCTAATAAACTTTATTTATAGACTTAGATGGTTAAAGCTGAAGGTGTTGAATAAATGTTTAGGCTCATATAAATGTTAACGTGGAAGATTTTGATTCGTGTTTTGTTGGATAATGTGAACATTTTTGGATGGTGTGTATTTTAAATGAAGCTGCACTAAATAAGTAATTCTATATTGTCCACATTTTCTCCATATTTAGTGTTTCAAGATTTTATGCAATGTAGATATGTTTTATCATAATAATAATATTTTTATTTATATATTTCTTGATATTTAATCCTGATTGTGCACATTGTGTAGCTTAGAAATATAATGTTGTCATAATAATAAAAAGACATTTTATTTACATTTTTTATGATACTAATGCTGCCTCCATATTCTATGACATAATAATCTTAATACTCACACTTTTAATTTATAAAATT
NOTES
Comment Citation
Between 413 bp to 420 bp of the wild-type hsf1 coding sequence, GGCCAGTT, is  ... Zebrafish Nomenclature Committee
OTHER ihb286 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (2)