Genomic Feature

ihb286

ID
ZDB-ALT-181009-1
Name
ihb286
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one delins (1)
Protocol
embryos treated with
Lab of Origin
Yonghua Sun Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Note
Between 413 bp to 420 bp of the wild-type hsf1 coding sequence, GGCCAGTT, is mutated into A. The mutated hsf1 codes for a truncated protein containing 153 aa, 137 aa of which is identical to wildtype hsf1.
Genome Browser
>
Variants
Variant Type
Delins
Variant Location
Chr 19: 3060540 - 3060547 (GRCz11) (1) Details
Nucleotide change
GGCCAGTT/A
Variant Notes
Between 413 bp to 420 bp of the wild-type hsf1 coding sequence, GGCCAGTT, is  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
1 bp inserted / 8 bp deleted from position 413 to 420 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
CTTAAACCAGAGCCGCTAAATAAACACATGAGAAGTTGTAAAGTATTGAATTAACACTATCTGTCAGCTGTCTAATTCTGGACTATTATAAGTGGATTTGGCTGTTAGCTGGTGACTTTGTTTTAAGCTGACAGCCCGAAGAGGGACATTTTATTGGTCATTGAGGTAAAGTTGTTACCCATATGGTTTACCATGCTACTTTTAAAAATTGGATCTGAAATAGCATGTTAAGTATGAATTTAAAATAACATTAGCCATATTTAATAAACTGTGAACAGTGTTGTACTTTGATTGTCATTGGCTGCTAATATGATTTCCCTATTAAGAATTTGTAAATAATACTTTTCTGAAATTGTAAAGTCCTAGTGTGTGAATATAAAGCTAACATTGTTTACTAAAACTGTTTGACTGCGTTTTCAGAATGGCACCAGTTTCCACGTCTTCGACCAGGGCAGGTTTTCCAAAGAAGTTCTGCCGAAATACTTCAAGCACAACAACAT
GGCCAGTT/A TTGTCCGCCAGCTCAATATGTGTAAGTATAAGAGGAATATGATAATGGCTTTAATCTGTTTAATCATTTTAATGACCTAATAAACTTTATTTATAGACTTAGATGGTTAAAGCTGAAGGTGTTGAATAAATGTTTAGGCTCATATAAATGTTAACGTGGAAGATTTTGATTCGTGTTTTGTTGGATAATGTGAACATTTTTGGATGGTGTGTATTTTAAATGAAGCTGCACTAAATAAGTAATTCTATATTGTCCACATTTTCTCCATATTTAGTGTTTCAAGATTTTATGCAATGTAGATATGTTTTATCATAATAATAATATTTTTATTTATATATTTCTTGATATTTAATCCTGATTGTGCACATTGTGTAGCTTAGAAATATAATGTTGTCATAATAATAAAAAGACATTTTATTTACATTTTTTATGATACTAATGCTGCCTCCATATTCTATGACATAATAATCTTAATACTCACACTTTTAATTTATAAAATT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations