ZFIN ID: ZDB-ALT-181002-634
Genomic Feature: sa45731
Synonyms:
Affected Genomic Regions: sptan1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 21: 13206384 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
CCTTCCAGCAGGAGGGCATCACCAACATCACAGCTCTAAAAGACCAGCTGCTGGCAGCCAAACATGTGCAGTCTAAGGCCATCGAGGCTCGTCACGCCACCCTGATGAAGCGCTGGAACCAACTACTATCCAACTCAGCAGCCCGCAAGAAGAAGCTTCTGGAAGCACAGGACCACTTCAGAAAGGTATGAAGAACGCAAATGTACCTGAAAGAAAACTATTTATTTGGTTTGCCTTCAACTCTTGTTCTCCATTCAGGTGGAGGATCTTTTCCTCACGTTTGCCAAGAAAGCCTCAGCCTTCAACAGCTGGTTTGAGAACGCAGAGGAAGATCTGACCGATCCTGTGAGGTGCAACTCTCTGGAGGAGATTAGGGCACTGCGGGATGCCCATGATGCCTTCCGCTCGTCCCTGAGCTCCGCAGAGGCCGACTTCAGCCAGCTGGCAGAACTCGATCGGCAGATTAAGAGCTACAACGTGGTGTCCAACCCATACACCTG
G/A
TTCACCATGGAGGCTCTGGAGGAGACCTGGAGTAACCTTCAGAAGATCATCAAGGTGAGGCGGAGTTTCTTTGTGTGTATGAAGTGTTTGCTATTAGATGGTATGATATTGGGCTACATTACATTTTCTGTTTGGAATATTCAGCAGTGAATTTGATTGAACTAAAAAAGGAAAGAACCAGAAAACAAAAGACAGACAGAAAGTAAGGTATAAAAATAATGGAACAATTAGAACGACAGATAAAGTGTACCATTTAAATAATTTTATACATTTTTCTGTGAATGAATAATTTAAAATTAATTTGATTAACACAGAATTAATAAATATTATGAATATTACTTTATTACCAAATAAGTATCTAATATGGCAACAAACGATCAAGATATTGTTAATATATGTATCAATTACTTCTAACTTTGCTGGTATCACACATAGTGCTGTTTAACAATTAATCACCTCTAATTCCAAATAAAATAAAAGTTTGTTTACACATTACAATT
(1)
OTHER sa45731 PAGES
ZMP:sa45731 (1)
GENOTYPES No data available

CITATIONS  (1)