ZFIN ID: ZDB-ALT-181002-6
Genomic Feature: sa45066
Synonyms:
Affected Genomic Regions: pcdh18a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 1: 13262392 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
CGCCGGCAGCCATTTTAAATGCGCCTGCGATGCCGCGTGATTGGTTGTGGCATGTCCGCTCGTCACGGCACCGCCAGGGTTTTGAAAGTGGGTATTGGCCGCCCAAACGGCAACTCCCTGTGGGTAGGCCGAACCTGTAGATGACGCCTTACCCGGTAGGAATCCCTTTCTGATCTCCATGCCGATGGAGGAAGCAGGCTGGCTGGTGGATTCGTCAAGCTCTCGGACGTCAGCATAAGAAGTTGGCAGAAGACGCTGGAAGACGTTGTTCATTTCTGACAGCAGTGAGCCGCCACATTCCTCCTCGTTGTCCTTTCCGAAGGTAGAAAAGCTCTTCTTAGCTGAGTCCACTGACTGCTGGTCCTCCTCAAGGACCTGAGGCCTGCTCTCTTCTCCAGGGATGAACATGTTCGCACGGTAATCCGAGGACGCCTGAGATGGCATCCAGCACTGGTCAGAGTGACCCAACACACGGCACTCCTCCGTACACAATCTCATGA
C/T
TGCTGAAAGGCAAAGAAAGATTTTTTTTTAGTAATCTAGAGTTTCTTTAGAAACTGACATCATCCATTACTGGCCTACAGAGTTTTAGTTGGTTTTATGTATGACTGTGAATGGGGATTGTTTTGACAAAACAAATACACTCACTGGCCACTTTATTAGGTACACCTGTTTAACTGCTCGTTAATGCAAGTTTCTAATCAGCCAATCACATGGCAGCAGCTCAATGCATTTAGGCATGTAGACATAGTTAAGAAGATCTGCTGCAGTTCAAGCTGAGCATCAGAATGACAAAGAAAGGTGATTTAAGTGACTTTAAACGTGGCATGGTTGTTAGTGCCAGACGGGCTGGTCTGAGTGTTTCAGAAGCTCCTGATCTACTGGGATTTTCACGCACAACATCTCTAGGGTTTACAAAGAATGGTCTGAAAAAGAGAATATTTACTCGAACGGCCTTTACGGTCACAAGATCTCAATCCAACAGAGCACCTATGGGATGTGGT
(1)
OTHER sa45066 PAGES
ZMP:sa45066 (1)
GENOTYPES No data available

CITATIONS  (1)