ZFIN ID: ZDB-ALT-181002-499
Genomic Feature: sa45589
Synonyms:
Affected Genomic Regions: actc1b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 17: 762364 (Zv9) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
TGGCCCCTGAGGAGCACCCAACCCTGCTCACTGAAGCCCCCCTCAACCCC
A>T
AGGCCAACAGGGAGAAGATGACTCAGGTACACACCAAGCAATTTAGTGTT
(1)
OTHER sa45589 PAGES
ZMP:sa45589 (1)
GENOTYPESNo data available

CITATIONS  (1)