ZFIN ID: ZDB-ALT-181002-158
Genomic Feature: sa45228
Synonyms:
Affected Genomic Regions: otpb (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 51618625 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
CTGGCCGCCCGTCTGATTGGAGTTTTGCTGTTGCTGCTTTTCTTGGTCTT
T/A
GGCGTTGACCTGCTGCATTCCATTAGGATTGGATCCACCATTACTTATTT
(1)
OTHER sa45228 PAGES
ZMP:sa45228 (1)
GENOTYPESNo data available

CITATIONS  (1)