ZFIN ID: ZDB-ALT-181002-132
Genomic Feature: sa45201
Synonyms:
Affected Genomic Regions: abca2 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 25123088 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
AACCAATGCAGAACTTTATTGTGGTTAATAAAGAAAATATCACCTTGCTT
A/T
TATTTCAGGATGAGGTCCCAGATCGCTCGACGGGCATATGGGTCTACTCC
(1)
OTHER sa45201 PAGES
ZMP:sa45201 (1)
GENOTYPESNo data available

CITATIONS  (1)