ZFIN ID: ZDB-ALT-180604-3
Genomic Feature: ihb245
Synonyms:
Affected Genomic Regions: csrp3 (1)
Type: Small Deletion (1)
Protocol: embryos treated with CRISPR1-csrp3
Lab Of Origin: Yonghua Sun Lab
Location: Chr 7: 16554324 - 16554330 (GRCz11) (1) Details
Sequence:
Current Sources: China Zebrafish Resource Center (CZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 7 bp deleted in Exon 3 (1)
FLANKING SEQUENCE (GENOMIC)
AATTTATACAAAAAAAAAATATTCAAGGGAAAAAAATTTTGTTGAATTTGTGTAGTTTGTCATTTTTTGTTTTAATTTTGCATGAATTTAAATGTATTATCTTTCCATTTCTAAAGATGTTCGGTGACTAAAATATTATTTGAATAAATGTATTGGTTTAGTAAATCTATTTTGTTCAAATACACCAAAATATATGACCTATATTCACTGAGAAATGGTTAAAAATATTCATTTTCAAAATCGGGTGTAGTCAGTTATGCTGAGCACTGTATGTACTGTATCCTTCATAAAAATTGGCATCTCAGTGTAATCAATGTAAAATGATGTTTGCATATGGACATGCATTAAGGGTATAAATCTGTCCTTAAAACTTGGTAAAAGTCAGTTCATGCATAACAAAAACGTTCAACATTATGAGTGTATTTTGAGGACGTACTCTTGAGGCTGAAGTTCTTCATTATTGACCGGGTCAGAACTCAAAGCTCCAGCACCCTGGCCAT
ACCCATA/-
ACCTTTCGGACCATATTTCTTGCCGTAGCAGGTTTTGCAGTATATCTCAGACTCATGTGCGGCAACTGTGGTGCTGTCCAAACCTTTACGACAAACCACTAAAAACAAACAAATCATGCATATATACATTTTTAAATGTTTACCAAATGATGTTAAACAGAGCAAGGAAATTTTCACAGTATGTATTATAATATTTTTTCTTCTGGAGAAATTCTTATTACTTTTATTTCAGCTAGAATAAAAGCCGTTTTAAATTTTTTTAAAGCCATTTTAAAGTCTAAATTATTAGCCCCTTTAAGCTATATGTTTTTTGATAGTCAACAGAACAAACCCATCATTATACAATAACTTGCCTAATTACCCTAACCTGCCTAGTTAACCTAATTAACCTAGTTAAGCCTTTAAATGTCACTAAGCTTTATAGAAGTTTCTTTAAATAATATTAACTGAATATTAGATATTTTTCCTGAATAAAAGCAGTTTTTTATTAATAAAAAATA
Comment Citation
Between 211 bp to 217 bp of the wild-type csrp3 coding sequence, TATGGGT is  ... Zebrafish Nomenclature Committee
OTHER ihb245 PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (2)