Genomic Feature

ihb245

ID
ZDB-ALT-180604-3
Name
ihb245
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Yonghua Sun Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Small Deletion
Variant Location
Chr 7: 16554324 - 16554330 (GRCz11) (1) Details
Nucleotide change
ACCCATA/-
Variant Notes
Between 211 bp to 217 bp of the wild-type csrp3 coding sequence, TATGGGT is  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
7 bp deleted in Exon 3 (1)
Transcript Consequence
None
Protein Consequence
None
Sequences
Flanking Sequence
AATTTATACAAAAAAAAAATATTCAAGGGAAAAAAATTTTGTTGAATTTGTGTAGTTTGTCATTTTTTGTTTTAATTTTGCATGAATTTAAATGTATTATCTTTCCATTTCTAAAGATGTTCGGTGACTAAAATATTATTTGAATAAATGTATTGGTTTAGTAAATCTATTTTGTTCAAATACACCAAAATATATGACCTATATTCACTGAGAAATGGTTAAAAATATTCATTTTCAAAATCGGGTGTAGTCAGTTATGCTGAGCACTGTATGTACTGTATCCTTCATAAAAATTGGCATCTCAGTGTAATCAATGTAAAATGATGTTTGCATATGGACATGCATTAAGGGTATAAATCTGTCCTTAAAACTTGGTAAAAGTCAGTTCATGCATAACAAAAACGTTCAACATTATGAGTGTATTTTGAGGACGTACTCTTGAGGCTGAAGTTCTTCATTATTGACCGGGTCAGAACTCAAAGCTCCAGCACCCTGGCCAT
ACCCATA/- ACCTTTCGGACCATATTTCTTGCCGTAGCAGGTTTTGCAGTATATCTCAGACTCATGTGCGGCAACTGTGGTGCTGTCCAAACCTTTACGACAAACCACTAAAAACAAACAAATCATGCATATATACATTTTTAAATGTTTACCAAATGATGTTAAACAGAGCAAGGAAATTTTCACAGTATGTATTATAATATTTTTTCTTCTGGAGAAATTCTTATTACTTTTATTTCAGCTAGAATAAAAGCCGTTTTAAATTTTTTTAAAGCCATTTTAAAGTCTAAATTATTAGCCCCTTTAAGCTATATGTTTTTTGATAGTCAACAGAACAAACCCATCATTATACAATAACTTGCCTAATTACCCTAACCTGCCTAGTTAACCTAATTAACCTAGTTAAGCCTTTAAATGTCACTAAGCTTTATAGAAGTTTCTTTAAATAATATTAACTGAATATTAGATATTTTTCCTGAATAAAAGCAGTTTTTTATTAATAAAAAATA
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations