Genomic Feature

ihb396

ID
ZDB-ALT-180523-4
Name
ihb396
Synonyms
  • stat5.2 D13 (1)
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Gui Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Note
None
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 12: 13622022 - 13622034 (GRCz11) (1) Details
Nucleotide change
CATAGAGGGATTG/-
Variant Notes
None
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
13 bp deleted (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
Polypeptide Truncation (1)
Sequences
Flanking Sequence
CGGTATTCCGTCTATTAAAGAGCTAAAATATTACAGCTTACATCATGTTTTGTGTCCAATTGCTTAGTTTTGTGACATTTAACTGTGTAATAAGGACCCAGATGGCAGCGGAATAAAGCACTTTTGTATCATACAAATGGCAAGCTTTCTATGATGCATTGTTTTTAACGCTGTTAAGAAAATCAATGGACATGTAGTTTCTGCAATTTTTTAGGTCTGAAAACCACATGTAGATGAAGCATTTACTTTCAGATTTGCAATGTCTAATATATGGATAACCATAATAACGAAGGGAACAAAATTATGTGTTATGTGACATTCATATTATCTTGTAAATCTGTCTTTGCACATCTTGTGATGGTTTTGTTGGGAAGCCTTGCTTGCATATTACATCCCTTTTATTTTGATCTTAGAACAGAGTCTGCATAGAGACACTCACCATGGTTGAGCCTCCAGCCATTGTGCCAAGTAGTGGCGCACCTCAATGGGGAAGTGCTGGC
CATAGAGGGATTG/- CATCTGATGAAGGGCGTCCCCCTGAAGCTGCTGTGCCTGAATCCACAGCGCCATGCCTGGCTCTGAACATAAAAAGAGAGATGTGTTTTTGCATCAATAACAATGCCATAAAAACTTCATCCCATGATGAAATACACTTTGTTTCACCTGCTGTTTCCTGGGTTAGATAAATGCACTGAAGCAGCATCTATTCATTTAAGTGCACTTATTAGTATACAAGCATAATTGCCAAATAATACATGAAACAGTGGGCACAGACTGCATTCAGATTGGAATATTACCCAACTTTTTACTGGATATTGCACAAAATACATTGTATTCTGCAAACTAGGCCTGCACCATATATAGTTACAGCATCGATATCGCAATGCGTGCATCTGCAATAGTCACAACGCAAGATATGCAATGTTGCGTCTAATTTATAGTTGACCAGGAGCTACAGAATACATGTGATTTGTAGAGTCACTTTAACCATGATTGAGTAAAGGTTTATAATTTGC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations