header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-180523-4
Genomic Feature: ihb396
Synonyms: stat5.1 delta 13 (1)
Affected Genomic Regions: stat5b (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN1-stat5b
Lab Of Origin: Gui Lab
Location: Chr 12: 13622022 - 13622034 (GRCz11) (1) Details
Sequence:
Current Sources: China Zebrafish Resource Center (CZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 13 bp deleted (1)
Transcript Consequence: Frameshift, Premature Stop (1)
Protein Consequence: Polypeptide Truncation (1)
FLANKING SEQUENCE (GENOMIC)
CGGTATTCCGTCTATTAAAGAGCTAAAATATTACAGCTTACATCATGTTTTGTGTCCAATTGCTTAGTTTTGTGACATTTAACTGTGTAATAAGGACCCAGATGGCAGCGGAATAAAGCACTTTTGTATCATACAAATGGCAAGCTTTCTATGATGCATTGTTTTTAACGCTGTTAAGAAAATCAATGGACATGTAGTTTCTGCAATTTTTTAGGTCTGAAAACCACATGTAGATGAAGCATTTACTTTCAGATTTGCAATGTCTAATATATGGATAACCATAATAACGAAGGGAACAAAATTATGTGTTATGTGACATTCATATTATCTTGTAAATCTGTCTTTGCACATCTTGTGATGGTTTTGTTGGGAAGCCTTGCTTGCATATTACATCCCTTTTATTTTGATCTTAGAACAGAGTCTGCATAGAGACACTCACCATGGTTGAGCCTCCAGCCATTGTGCCAAGTAGTGGCGCACCTCAATGGGGAAGTGCTGGC
CATAGAGGGATTG/-
CATCTGATGAAGGGCGTCCCCCTGAAGCTGCTGTGCCTGAATCCACAGCGCCATGCCTGGCTCTGAACATAAAAAGAGAGATGTGTTTTTGCATCAATAACAATGCCATAAAAACTTCATCCCATGATGAAATACACTTTGTTTCACCTGCTGTTTCCTGGGTTAGATAAATGCACTGAAGCAGCATCTATTCATTTAAGTGCACTTATTAGTATACAAGCATAATTGCCAAATAATACATGAAACAGTGGGCACAGACTGCATTCAGATTGGAATATTACCCAACTTTTTACTGGATATTGCACAAAATACATTGTATTCTGCAAACTAGGCCTGCACCATATATAGTTACAGCATCGATATCGCAATGCGTGCATCTGCAATAGTCACAACGCAAGATATGCAATGTTGCGTCTAATTTATAGTTGACCAGGAGCTACAGAATACATGTGATTTGTAGAGTCACTTTAACCATGATTGAGTAAAGGTTTATAATTTGC
OTHER ihb396 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous stat5bihb396/ihb396 stat5b Unknown
stat5bihb396/ihb396 stat5b ♀+/- ♂+/-

CITATIONS  (2)