Genomic Feature

tsu3994

ID
ZDB-ALT-170831-3
Name
tsu3994
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one point mutation (1)
Protocol
embryos treated with ENU
Lab of Origin
Meng Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Notes
No data available
Genome Browser
Variants
Variant Type
Point Mutation
Variant Location
Chr 13: 7725949 (GRCz11) (1) Details
Nucleotide change
T/G
Variant Notes
tsu3994 mutant embryos carry a T -> G single nucleotide substitution in the  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
T>G in Exon 23 (1)
Transcript Consequence
Nonsynonymous (1)
Protein Consequence
Amino Acid Substitution: Leu>Arg (1)
Sequences
Flanking Sequence
CTGGAGCAGCTGAAGAGGTTTGATAGAGTTAGCTAGGAGCCCGGCTAGTAGAGAGTTGCAATAGTCCAGTCTGGAGAGAACGAGATAGGATAGGGTCGGATCTTTTTTAATTAAAATATACATAACTGTTTTCTTAGTCATTTGAACTTTTCGATTACATTCATAACAAATAGAAACTACTAGAAAAGTCCAAAGTTCAAACCTGAGTCACGCAAGCAGCTGTCTTATTCAGTGCTGCCATTACTTATCAACAACTGTCACTATGGTGCTGCATAGGTACTGGGGTTCAGAACCCAAACCACCGTGTGAACAGTTCAGGGGGAGCTGGGCTCAACCAAACTTGAGTGTGAACCAGGCAGTCAAGCTCAATTTGAAGGTAGTCTAAGAATTGTCGTTGTACTCTCCACAGGTTCTCCTCTCCCTTCGCCTGCTGCTGATGATGAAACCTCACGTCCTGTCTAGAGTCAGTCGGGAGGTGGCCTACGGCTTGCATGAGCTGC
T/G TAAAACTAACGCTGCCAACATCCACAGCACTGACGATTGGTACACTCTCTTTTCCCTCCTGGAGTGCATCGGCGCTGGGATCAAACCTCCGGCTGCTCTGCAGTTCGCCAACACTAACCCAGACAATGACACAGGTGATTCAAGGAATTCCCACTTATTTCCAACCATTTTATCTGTTTCTGTACCGCAAGATGCAGTCGAATGTGCCGTGATGTTTCTTTTCCAGATTGGCTTATCTTGTGTAATCCCTTTGTTTCAGGCGCGCAGTCAGACAGTGAACTCAGCTCATATCATCAGAGTGAAGTTAGTCTTGACCGGGGATACACGTCCGATTCTGAGATTTACAACGAGCATGGCAAATCCAGAATACCCCGTTCTGCTACTGATGTGGATGTAGGCTGGCTAGTGGTGAGTATCCACACAATGCACCAGAAAGCATTTTTTTATTTTAAATTATTTACATTTTAAAAGAATAAGCAGTAACAAAAACAACCATCAAC
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations