ZFIN ID: ZDB-ALT-161003-20724
Genomic Feature: sa6509
Synonyms:
Affected Genomic Regions: nlrc5 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 18: 17637331 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
AGAAAATTTTGGACCTTCTGCCTAAACTAGGAGGAATTCAGGAGATAAAG
T/C
AAGCAAAACACTTCATCTGCAATTATTTTAGTCTGAACAGTAAGATGGTG
(1)
OTHER sa6509 PAGES
ZMP:sa6509 (1)
GENOTYPESNo data available

CITATIONS  (1)