ZFIN ID: ZDB-ALT-161003-20466
Genomic Feature: sa34640
Synonyms:
Affected Genomic Regions: ackr3a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 9: 24045688 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: C>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
ATACCCTGAGACCCATCAATGAGTCGAGCAAGCCCCGTACGGGTGGAGTATTTGAAGATGAAGGCTTTCATGAGATCATAGCGATAGTGGCGATGGGCGAAGCTGTAGACCACAGGATTTACACAGCAGTGTAGCAGCGACAGGCATTGAGTAAGGTGAAGTGCCACAAACAGACCATTCTCTGAACTGCAGCCCAGTGGAAGCACACCTAACATGGCTAGAGCATCGGCTAACAGCACCGCATGATATGGTGCCCAGCAAGCTATGAAAACCACTATGTACATTAAGATGACCTTCTTGCTCACGCTTCGATCCTGGTCTCCATTTGAAGGTGAATGAGTGGAAGTGGAAGCTAAAGTGTTTGCCAACAATGCATATGACACAGCTATAATAGGGAAAGGTATGGCAAAACCAAGAACTACAAAACTCAATTGTATGCCCACCATCCACTGCAAAGGGTTGTCCTCTGGGTATACAGGAAGACACAAGGTCACGTGACT
G/T
TATTGTGACTTTACAGACCGCAGGAAGTATGTGTCGGGTACTGAGGCGAATAAAGCAAGCAGCCATGTTATCGCACACACTAAACGCCGAACTTGTCTTCCTCGTCTGTGAGAAATCTCCCTAAATCGCACCACCGAGAGATACCGGTCCACACTCATGCAGGTCAGGAAGAAGATGCTGGCGAAAAGATTGACGCTGAACAGAAGATGTGTGAGTTTACAAGCCGCCTGACCGAATGCCCAGTGTCCTCCCTGTGCCAGCGAGCTCACCCACACAGGAAGAGTAGCCACTACACACAGGTCAGCCACCGCTAGGTTTAATATATACATGTGCGTCTCGTGGTAATGACGCTGAGAGCGCATGTTGACCCACACTACTAGCGCATTGGCAGCCAGGCCAACGACAAAAATGAAGGCATAGAGGGTGCACATGGCATTGAGGAGAGCAGAACGGTTAAAAGAAGCCGGGCACATTTGCGCTTCAACCCGTGAGCTGTTGTT
(1)
OTHER sa34640 PAGES
ZMP:sa34640 (1)
GENOTYPES No data available

CITATIONS  (1)