ZFIN ID: ZDB-ALT-161003-20036
Genomic Feature: sa938
Synonyms:
Affected Genomic Regions: stat3 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 3: 17081226 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
TATCTATAAAAGTTGCTGCATTACTTTAGCCCTCTGCTTTTTTTTCTTCA
G/A
TTCACGCAAGTTCAACATCCTTGGCACTAACACTAAGGTGATGAACATGG
(1)
OTHER sa938 PAGES
ZMP:sa938 (1)
GENOTYPESNo data available

CITATIONS  (1)