ZFIN ID: ZDB-ALT-161003-19129
Genomic Feature: sa7629
Synonyms:
Affected Genomic Regions: rif1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 9: 22787486 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Missense (1)
FLANKING SEQUENCE
AATCCTGTAGGTGCTCATCCCTGAAATGCAGAAGCTCTTTGCGTCTAAGA
A/T
CGAGACAAACATGTTGAAACTCTGGCCTTTGTTTGTAAGACTTCTGGGCA
(1)
OTHER sa7629 PAGES
ZMP:sa7629 (1)
GENOTYPESNo data available

CITATIONS  (1)