header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-18754
Genomic Feature: sa7129
Synonyms:
Affected Genomic Regions: notch2 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 8: 19599025 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>G (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
AATGACCGTCTGAATGATTATACCTGCGTATGCGCCCGTGGGTTTGCAGG
T/G
AATGGCATGTGATCCTTTCTAAACAAAGTAACAAAGACATTTAGGTCATA
(1)
OTHER sa7129 PAGES
ZMP:sa7129 (1)
GENOTYPES No data available

CITATIONS  (1)