ZFIN ID: ZDB-ALT-161003-18600
Genomic Feature: sa6902
Synonyms:
Affected Genomic Regions: prl (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 3: 32342002 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
AAGAAACCTGTTCTAGTAATGGCTCAAGGGTCTAGACTATACTTTGCAGG
T/C
ATCTTATCCTCAATCTAAACATTGCCTATTTTACACTTTATGGCTATCTT
(1)
OTHER sa6902 PAGES
ZMP:sa6902 (1)
GENOTYPESNo data available

CITATIONS  (1)