ZFIN ID: ZDB-ALT-161003-18501
Genomic Feature: sa6748
Synonyms:
Affected Genomic Regions: pmelb (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 23: 35672632 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>G (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
CTATTCTCTACAATATTCATATTATCCAGTTTGTCCGGGGGATTAACAAG
T/G
AAGTAAACACTGTTTCCTTATTATTTATATAGGTGTATATTAGATTAAAA
(1)
OTHER sa6748 PAGES
ZMP:sa6748 (1)
GENOTYPESNo data available

CITATIONS  (1)