ZFIN ID: ZDB-ALT-161003-18211
Genomic Feature: sa6390
Synonyms:
Affected Genomic Regions: col4a4 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 15: 35960077 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
AAATAAGTTAAATAAATTAAGCCTAAATCTTTGTTTAAATAGCAGATTTATTTATTTTCTCTTAAAAATTTGACTTTTTGTATTAAATTGATAAGTGTGTTAAAAATTACACACATGTATGTATTCTAAACAAACAATTCTGATAATAACTGCAAATGATGCACGTTTTTATAAATTTTTTAAAAAGCCTGCATCGTCAAATTATATAATATGAGTTTTTTTTTTGCCAATATAAATTAAAATTCATTAATAAATTAATATAGAATGAAATTTATTTAAAATCACCAAACACCAAGCCAGAACCATGACTAATCAAATTAAATCCTTTTTAAGTCTGGACCAAATGGAGCACAAGACCAGAACTACAAGTGTTAACATAAAAATGTCAGATAAAATATATATGTGTCTAATAGCATTTGTTGTTACATAATACGGTTCTTACAGAAACCTAGACAGTAATCATAGTCACTTTTAAATGTCAATATGAGCTTTAGCCACAT
A/T
CCCAGATCTTGTGTGTGTGCTCTCTCCTGACCCTCCAGGTAAAGCAGACTGTAGCCGTTCCACAACTGTGTAAGGCCTGCAGGACAAGTCGGCACATAGCGGGACTGGCTGTGCATCACTAGAAGAAAGCCTGTAGAAAGTGTCTCATTTCTTCCAGGGGGACCTCGATCACCATCTGGTCCCGGAGGTCCTGGTATAGAAAAGGATAAGATGGTATGTCAATAAGATGATGCACAAATGGCTGGATGTGAGTTGCTCTTGATAAATGCTAAAGAAATGAAAAAGAATGAAGTGATTGAATGATTGGATGGCAAGAGCAAAAAGATAAAACAGTAGCTATGTTTCCATCCAATTATTTTTATGAGAATTTAGGAATATCATTAAGAATGCTTTATTGACATGCCAAGATGTGCAAAAAATTTTTTTAAATATGCATAAAAAACAGATAGAAGTAGGATAAATGTTCTATCCAATAAGAATAATCGTGCATAAACTACAAA
(1)
OTHER sa6390 PAGES
ZMP:sa6390 (1)
GENOTYPES No data available

CITATIONS  (1)