ZFIN ID: ZDB-ALT-161003-17967
Genomic Feature: sa6064
Synonyms:
Affected Genomic Regions: srek1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 55171260 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
TCATTCTGATTGCAACTGTATATACATGCAAAGAAAATGTGTGTTTATATATAAAATATTTAAAATAAATAATATATAAACATGGATATATATGTAAATATGTTTATGTGTACATCTACATATACACTACTACATACATGTACATAAAAACATTTATTTTATATATGATTAGTCACCATAAATTTTCAAAGAGCACTACATGGTACATTACTGATTATTTGTTTAAATCTTTCTTTAGTCCATTAAAGTTCCTTTTAAATGGATTAGATTTGATTTGAACAGTTATACAATTACAAAGGGATAATAAATCTTTGCACTTTTACCATGTAAATATAATACTAATACCCCTAATATATCTACATGGTCAGTAAGATTATTTTTTGTTAATGTAGTCAGCATAACTTGTGTAGCTCAATAAATGAGTAGCTTCATAGTATTTTAACTGCTTCATATAGTGAGTAGCTATTGGCTTCACAAACTACTAAGGTTGCGTGTAAATC
A/G
CCTGTGTCTAGACCTGGATCGCTTTCTTCTTGAGTTAGATGGAGAACAAGAGTGAGATCTGGACCTTCTGGAATGCCTGGATCTACTGGATGAAGGGAGTTCATTTTCTGCAAGAAACAAATAAAATTGCCATAAAATAAAAAAGATAAACATGAAAGCATCACTATGAGAGAGTCAGGGTTTTAAGAAGACCAACCTGGCTCGATAGCAGCAGCAATGGTTGACTGAGCCTCTCTGACTTTCTTCATGACGTCCTCTAGCTCTTTGGCTGCAGCTTGGGGTGTAAGCTCTGGAGGCTTCACTATGGCATTATTGGAGTGGTTAATCCTGAATAAGATGAAGTCAGGCTGATCAATCACTTATAAAAATAGGATGCACTAAAACTTTTCAAAAAAAAATATTTGTTTTTTTTATTTGTTATTAAAAGCAGGGACCAGGAAGGGATGTCCAATCTTGATTCTAGAAGGCCTACGTTACACAGATTTTTAGTTCTAGCAAAC
(1)
OTHER sa6064 PAGES
ZMP:sa6064 (1)
GENOTYPES No data available

CITATIONS  (1)