header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-17637
Genomic Feature: sa5114
Synonyms:
Affected Genomic Regions: lrrk2 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 25: 35623779 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
TGACAAGCATGAAGGCAATGTGGATCGAAAGTAACAGTGTGTTTTTATAC
T/C
GAAGGGGATGGAGGTTTTGGCTCGGTTTATAAAGCTGTCTACAAGAATGA
(1)
OTHER sa5114 PAGES
ZMP:sa5114 (1)
GENOTYPESNo data available

CITATIONS  (1)