header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-17058
Genomic Feature: sa41154
Synonyms:
Affected Genomic Regions: abl2 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 8: 14970712 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
GCCTCAGTCATGAAGGAGGTCAAACATCCCAATCTAGTACAGTTACTGGG
T/C
GAGTAAACTATCATTAAAGGAAATAGTTCACCCAAAAATGAAAATAACAC
(1)
OTHER sa41154 PAGES
ZMP:sa41154 (1)
GENOTYPESNo data available

CITATIONS  (1)