ZFIN ID: ZDB-ALT-161003-16965
Genomic Feature: sa40496
Synonyms:
Affected Genomic Regions: taf1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 36563373 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
TGACCTAAACTACAACTGAAGTTTACTGTGTCCACACACAGATCTTCCTG
A/G
CCTTACGGAGTGTGTCCAGATCCATGGGGTTGATGATGACTTTATAATAG
(1)
OTHER sa40496 PAGES
ZMP:sa40496 (1)
GENOTYPESNo data available

CITATIONS  (1)