ZFIN ID: ZDB-ALT-161003-16964
Genomic Feature: sa40495
Synonyms:
Affected Genomic Regions: taf1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 5: 36558278 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
GCACAAATACTCAAGCATACACTTACAGGAGAATGGATTATCGCCTTCCT
C/A
CTCACTGGCATCATCTTCAGCATCTGACATCAGCAGATCCTGGTAAAGCA
(1)
OTHER sa40495 PAGES
ZMP:sa40495 (1)
GENOTYPESNo data available

CITATIONS  (1)