ZFIN ID: ZDB-ALT-161003-16903
Genomic Feature: sa40145
Synonyms:
Affected Genomic Regions: ints1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 3: 43048464 (GRCz11) (1) Details
Sequence:
Current Sources: Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>G (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
GCTTTTTATTGGCAGTTTAAGTAGTTATTTATTGTTTGTGTGCTGTTTAC
A/G
GTATAATGAGTAAGAAGTGTCAGACGCTGCTGCTTCAGATCTATCTGCAC
(1)
OTHER sa40145 PAGES
ZMP:sa40145 (1)
GENOTYPESNo data available

CITATIONS  (1)