header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-15766
Genomic Feature: sa38248
Synonyms:
Affected Genomic Regions: dmd (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 1: 10908478 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS No data available
FLANKING SEQUENCE
AACAAACCCAAAGTCACGAAGCGCCAGTGAAGCTGACAGTGAAGATCAAA
C/T
CTTAACGTGATACGTCTTCCTGTGCAACATATCCGGTGATTGACTGGCAT
(1)
OTHER sa38248 PAGES
ZMP:sa38248 (1)
GENOTYPES No data available

CITATIONS  (1)