header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-15148
Genomic Feature: sa35026
Synonyms:
Affected Genomic Regions: si:ch211-247n2.1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 11: 8316687 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
GTGTCCCTTAAGCAGGACGATTTATCAGAAGATTCGAGAGTATGATATTT
T/A
GGAGAAGAGGAGGACGGTGACCGCGCTGAAGGCTGGAGAGGACAGAGCCA
(1)
OTHER sa35026 PAGES
ZMP:sa35026 (1)
GENOTYPESNo data available

CITATIONS  (1)