ZFIN ID: ZDB-ALT-161003-14771
Genomic Feature: sa3308
Synonyms:
Affected Genomic Regions: hsd17b12a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 25: 30196351 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>G (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
GTGCTGGGAAACGGGGACTTACTCTCTCCCAAATTGGGAAAATGGGCAGG
T/G
AAGTTGAACGACATGAGAGCTTGTATTGGCAGATCATGGGTGGGATAAAT
(1)
OTHER sa3308 PAGES
ZMP:sa3308 (1)
GENOTYPESNo data available

CITATIONS  (1)