header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-14086
Genomic Feature: sa30459
Synonyms:
Affected Genomic Regions: col22a1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Unmapped
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
TCATCCTACAGGGTGATACAGGTCTACCGGGTGCCCCGGGGCCCAAGGGT
G/T
AAAAGGTCAATTAGCATTTTACAATCACAACATCCTCAATATGCATCTTC
(1)
OTHER sa30459 PAGES
ZMP:sa30459 (1)
GENOTYPESNo data available

CITATIONS  (1)