header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-13729
Genomic Feature: sa29312
Synonyms:
Affected Genomic Regions: dab1a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 20: 8154154 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS No data available
FLANKING SEQUENCE
CACTACTCACGTGAGTTGGTGGAGGGTGTGGTGGAGGTGACGGGTGTGAG
G/A
TTCATCTGCGAGATATCGAAGTCGTCACAGTCATCCGTGTCTTGCGCCAT
(1)
OTHER sa29312 PAGES
ZMP:sa29312 (1)
GENOTYPES No data available

CITATIONS  (1)