ZFIN ID: ZDB-ALT-161003-13565
Genomic Feature: sa28836
Synonyms:
Affected Genomic Regions: add3b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 17: 20259354 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
GAAAAGCTTCCTCTATCGTCTCTCCAAACGCCAGTAAACCTTGATTCCTC
T>A
AGACTAAAACCTACAAACAAGCAGAATTGCATTACTGTTGTAAATCCACT
(1)
OTHER sa28836 PAGES
ZMP:sa28836 (1)
GENOTYPESNo data available

CITATIONS  (1)