ZFIN ID: ZDB-ALT-161003-12743
Genomic Feature: sa26072
Synonyms:
Affected Genomic Regions: rbfox1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 3: 28045707 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
TAATCTGTCTTCTGTTCTCTTTCCAGCAATTTGGTAAAATCTTAGATGTT
G/T
AAATCATATTTAATGAACGAGGATCAAAGGTACGTTTTGTGACTTTTATC
(1)
OTHER sa26072 PAGES
ZMP:sa26072 (1)
GENOTYPESNo data available

CITATIONS  (1)