ZFIN ID: ZDB-ALT-161003-12590
Genomic Feature: sa25583
Synonyms:
Affected Genomic Regions: cdkn2a/b (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 1: 26130962 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>A (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
ACGGAGTGAATGCCAATGTGGTTAACAAATTTAGAAGAACGCCTATACAG
G/A
TAGGTTTAGACGCGCTTTAAGAATAAACAACGGAAATAAACAAATGCAAA
(1)
OTHER sa25583 PAGES
ZMP:sa25583 (1)
GENOTYPESNo data available

CITATIONS  (1)