ZFIN ID: ZDB-ALT-161003-11233
Genomic Feature: sa21632
Synonyms:
Affected Genomic Regions: ash2l (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 10: 2765048 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: T>A (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
CTACTTATACTTTGAAGAGAAAGATTATGTGGACAAGGCTGAGAAGAACT
T/A
GAAACCCACCAGTACCAGCAGAGTGAGTCATTCAAGACATTTTTTATATT
(1)
OTHER sa21632 PAGES
ZMP:sa21632 (1)
GENOTYPESNo data available

CITATIONS  (1)