ZFIN ID: ZDB-ALT-161003-10588
Genomic Feature: sa1919
Synonyms:
Affected Genomic Regions: snap29 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 8: 1839765 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
TAATATAATTTAGAAAAGTATATAAATATTAATAATAATTATTTAAAATAAATATAATAATTATATACTACTAATAATGACTTTTGTTTTGTTTTTTGCTGTTATTATTAATATTTTTATTATTTTTATTATTATTATTATTAATAATAATAATAAATGAATAATAATTTTTTTCAATATTTAGCCTTTTATTGTTATTCTGGAACAATTACAATTAATCTTTAATTGGACACCCAACAGTTTATTATCTGTCAAGGAAAAACAAAGAAAAGTACAAACGTGGGCTTAAACACTGATCTCTATATAGAATGACTATTTTCTAAGTTCTCTATCCATACGGATCGTCATCTGGCACACATTATTTATAGATCAGTGGTGTAGCGACAAAGGGGAGCCAATATATGACGTCACCGTGACACCACCGGAAGTCGTCCGAGCAAAAGCGTCAGCTGATAACAGGAGAACAGAACAGAACACTTCACCTCTTCCAGCGACCAAAG
G/T
TACAAATTCAGCGATAAAACGTTCAAAATATAGTTTGAGAGTTATGTTAAACACGCGATTTATGTTATTAAATATAACGTAGGTCATTTGTAGAGTCTGTGTTAGGTAATATAACGTACTATAGCCGAGAAAGAAAACAGTAACAGGCGACTTTCTACAGCATATTCACCTGAAATGTCGTTAAATGTTGAAGATTATATAGGATAATAACTGTTGTAAATGTTATTATGCTCAGTCTGTATATATGATTGTTTGTCGGTGAGCATTTGCCAGATATAATAGTTTATTCAGGACACACTTCGTCCATTTATCAAGATCTATTTAACTATTAACAGAAAGTACCGTCTTTTTAACGTTTACCATTAGCTATAGAGCTAAATCTGCCTTATAATTAATCTTTTACAGCAGAGCTAATTAAAATTTAGCATTGTACAACCTTTTGATCTTCCACAACCTTTTTATTTCAGCTTAAATATCTGTATTATTTGGTCCTTATGTTG
(1)
OTHER sa1919 PAGES
ZMP:sa1919 (1)
GENOTYPES No data available

CITATIONS  (1)