header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-10537
Genomic Feature: sa19086
Synonyms:
Affected Genomic Regions: kdrl (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 14: 33021418 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
TAGCATATGAAATCAGAAAATAAACAGTAAATGTGAACATTGATTGACCT
A/G
CTCTGTAAGATTAGCACTGGGGTCACATGGCTGCCAAAACCAGGTAATGT
(1)
OTHER sa19086 PAGES
ZMP:sa19086 (1)
GENOTYPES No data available

CITATIONS  (1)