ZFIN ID: ZDB-ALT-161003-10529
Genomic Feature: sa19068
Synonyms:
Affected Genomic Regions: pcdh15a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 13: 41441151 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
TAAATAAATAAATAAATAAATGAACACATTTGAGATATCATAAAAATAATAAATAAATAAATAAAATACATAAAAAATAAAATGCCTAAATAAATGAATAAATAAATACATAAATAATTGCATGAATAAATGAATGAATAAATAAATAAATAAATGAGCACATTTGAGATATCATAAAAACAATAAATAAATAAATGACTGAATACATTTGAGATAGTATAAAAATAATAATTAAATAAACAAATAAATAAATGAATAACCCCCCAAAAATTTGTACTTTTTATTACCTTTTTCATATAAATCATAAAGTGGTTAGTAAGGTTAATATTTGTATCAATAATACATTTGTGCGCAAACTAATCAACAAATTTTTTCTTCTCAACATAATTGAAGTTTGACACCCCGATCGATATTTTAAGTACAGAAGTGTTGAACGACTTTAACAGGTGAATGAGTGGAGAGTGGAAAAAAGATGTGAAAGAGGAAAGAAAAGCAGTCTT
A/G
CCCTCATAGTGCCAGTCTGAGGGACGTTAGTGTCAGCAGCAGAGAAAGGAGAAAAGAAGAGAAGAAAAGGAAAGATACATATGAGAAGACAGCCAGACAGAGAAACACAGAGAATTGTGCACAGAACAAGGCTGCGTGCCATTAGAAATGAAACGACAATGCCTTTAAAGTTCAAGCCAATTGCAGAATTTGAGTAAACGAGAAAATAAAATGTTATTCAAAGATATTTAAATTCAAATCACTCTGAATAAAAGCCTCTGCTGAATGTCTGAATTTTGAGTCTGTGTGAATAATCAATAGATGTTACAAGACCACATAAAAATGCTCAGTTTATTTAAATTTAACCCTCTGGGGTCTGAGGTGATTTTGGGACCCCTAAAATGTTTTGACATGTCCTGACATTTGTGCTTATTTTAGCTACTTAGCACATAGCATTGGCCAACATTTATTGTTTTGTATTCAGCACAAACTGTGCTACAATAATATATGGGAAAGATGGA
(1)
OTHER sa19068 PAGES
ZMP:sa19068 (1)
GENOTYPES No data available

CITATIONS  (1)