header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-10363
Genomic Feature: sa18749
Synonyms:
Affected Genomic Regions: pold1 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 3: 16712330 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
GTGATGCGCAGGAAGTCATGAGGTTTGTTTCCATGGTAATTATACATACC
T/A
AAAAAAAAAAAAAACACGAAAGACGGATTCATTCAGAATTAATAACATAA
(1)
OTHER sa18749 PAGES
ZMP:sa18749 (1)
GENOTYPESNo data available

CITATIONS  (1)