header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-161003-10242
Genomic Feature: sa1569
Synonyms:
Affected Genomic Regions: slit3 (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 14: 24591538 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: A>G (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE
TACAAAGTGAAACATGCCTTTTTTCTAACGTGTTCTGTCTTCTTTTTTCT
A/G
GCACTCTCAACAACAACAATATCACCCTCATCCCACTGTCAAGCTTCAAC
(1)
OTHER sa1569 PAGES
ZMP:sa1569 (1)
GENOTYPES No data available

CITATIONS  (1)