ZFIN ID: ZDB-ALT-161003-10055
Genomic Feature: sa1048
Synonyms:
Affected Genomic Regions: gata1a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 11: 25418764 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: T>C (1)
Transcript Consequence: Splice Site (1)
FLANKING SEQUENCE (GENOMIC)
AGCTTAATTCAGTGCTAACTCTGTGCAATGTTTTAACCAAAGCATATGTGTGGTTGTTTGATGTATCAAACCTTTAATATGAATACAGACTGTAACGTTCAGAATACTTTTTTGTTGTAAATTTGCATATATGTATGGTATATACTAACATAAATAACATGATAATAATAACACAAATATACATAATTACAATTATTTCACTTGACATTTGAATAAACGTTTAACATTTCATCATTGTTGCAGGATTTAAAAGCAATTTACTTATTAAGTGCTTACCTGACTTAACATTTTAATGTCAATATAAGTGTATTAAACATACTGCAAGGTTTAAAAGCTGATTAAATCAAGTGTATCACATACTTGGCAAAATTTAAAGACGTAGAAATGACAGATAAACAAATAATTATTCCAGTAATTAACATAATAAAAATAATTGAGTGAGTATAAAGCCAGCTCATGTGTTGTTAGACACTTTTTACTGACACCGTATTTATGAACTT
(1)
OTHER sa1048 PAGES
ZMP:sa1048 (1)
GENOTYPES No data available

CITATIONS  (1)