header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-160721-31
Genomic Feature: hu10965
Synonyms:
Affected Genomic Regions: ccbe1 (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN1-ccbe1
Lab Of Origin: Schulte-Merker
Location: Chr 21: 10577723 - 10577729 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 7 bp deleted (1)
Transcript Consequence: Frameshift, Premature Stop (1)
Protein Consequence: at position 23 (1)
FLANKING SEQUENCE (GENOMIC)
ATATTTTATATTTGATCAAATTACTTTTGTATTAAATAAGCCTGGAAATATTTTTGACACACAAACACACACAAATTCTCCAAACATCTGAAAGGAGGTTTAAACATCTCAAAACAACCATATGAAAAGTTAATACCACAATGACATCTTTCCACAAGTCTAACATATTATATATTATTTTAAACTTCTGCATGCCTTTTTTCAGCGATGCCCTTATGTTACCTGAGGCAGTTATTTAAATATTACTTTCAGTTTTTCTGAACCTATGGAAGCCGATCAAGTGTGTCGGTGGGAGGGGCCGTGTGGAATCTGCGCGTGGGGCTTCGCAGGAGGTAACCAATCAATACTCTCCCAATTCCTCCGAAACAAGCGCTGAACTTCAAGACTGGATTTAAAGGGACAAATATCTTTTAATCATCTCAGAGTGTCTGAAATGATCTACCCGGGCAGAGGAGCATCTCTCAGTGTGGCCGTGGCGCTCGTACTGTTCTCATCGGGAG
CTCCGTG/-
GACTTTCCGAGAGGAGAAGGAGGATGTAGACAGGTAAAGTGCTGTGCTGTCTGTCTGTCAGCTCGCTGTTTACACGAACCCAGCGGATGGAAAGTTTGTTTCCTGTGAGTGAGCACAATTGTTTATGCGCAAAGAAAACAGCTGACGGCTTCTTGTCTTGCAGAGAAGTGTGTTCAGAAAGCAAAATCGCAACGACGAAGTACCCGTGCGTAAAGTCCACTGGAGAGGTGACCACATGCTACAGGTAAACGCGCTGTTTACTTATCCATCTAAAAACGTCATGTGTTTGTGTATTGTCTGTAGGCTACTCGATATTTTGTAATATTAAGGTAAAGTTGGTTTTGTATTCGCACATTTGTTCATTTTTGAACAGTAACACCTTGACACTGTCTCTATATTGCTTACCAGGTTACTTTAAATATTCGGTCTAACATGCAGGTATGACTAAAACAACATTAGCACTATTTAATTGTCTGTAAACAATGTACTTTGATAGTCAT
NOTES
Comment Citation
Frameshift at aa 23; additional 8 aa then stop. Kok et al., 2015
OTHER hu10965 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous ccbe1hu10965/hu10965 ccbe1 ♀+/- ♂+/-
Complex ccbe1hu10965/hu10965 ; hu7135Tg ; hu5333Tg ccbe1

CITATIONS  (2)