header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TALEN-150414-2
TALEN Name: TALEN1-ccbe1
Target: ccbe1 (1)
Source:
Target Sequence 1:
5' - TGGCGCTCGTACTGCTCTCA - 3'
   
Select Sequence Analysis Tool

Target Sequence 2:
5' - TCCTTCTCCTCTCGGAAAGT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This TALEN includes a single nucleotide polymorphism compared to the sequence in Ensembl.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM TALEN1-ccbe1 No data available
GENOMIC FEATURES CREATED WITH TALEN1-ccbe1
Genomic Feature Affected Genomic Regions    
hu10965 ccbe1    
GENE EXPRESSION
Gene expression in Wild Types + TALEN1-ccbe1 No data available
PHENOTYPE
Phenotype resulting from TALEN1-ccbe1
No data available

Phenotype of all Fish created by or utilizing TALEN1-ccbe1
Genome Resources:
CITATIONS (2)