header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-160601-7217
Genomic Feature: sa41159
Synonyms:
Affected Genomic Regions: ttc39a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 8: 16474123 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: A>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE
TCACCACAGATGACCAGTGTGTGGTTAGTTTGCTGAAGGGCCTCTGTCTC
A/T
AACACTTGGGTTACAAGGAGGAAGCAGAACATTACTTCACCCTCGTCCTC
(1)
OTHER sa41159 PAGES
ZMP:sa41159 (1)
GENOTYPES No data available

CITATIONS  (1)