ZFIN ID: ZDB-ALT-160601-4059
Genomic Feature: sa35689
Synonyms:
Affected Genomic Regions: kctd16a (1)
Type: Point Mutation
Protocol: adult males treated with ENU
Lab Of Origin: Stemple Lab
Location: Chr 14: 23812393 (GRCz11) (1) Details
Sequence:
Current Sources: European Zebrafish Resource Center (EZRC)    (order this)
Zebrafish International Resource Center (ZIRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: G>T (1)
Transcript Consequence: Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
AGAGTTGCTCTTCTGATGTGGTGGAGCTCAATGTAGGTGGACAGGTGTACTACACTCGCCATGTCACCCTCACCAGTGTGCCAAACTCACTGCTGGGTAAATTGTTCTCCTCTAAAAAAGACATTTCTAACGACCTCACGCAGGACATCAAGGGACGCTACTTCATCGACCGGGACGGATTTCTCTTTAGGTACGTGCTGGACTATCTCCGCGATAAGACTGTCGTCCTGCCGGATTATTTTCCGGAGAAGGGGAGGCTGAAACGCGAAGCTGAGTTTTTCCAGCTGCCCGAGCTCGTCAAAATCCTAACCCCAGATGATTATAGTCACAGTGATTTTGACGAAGCATCCCAGGGAAGCGACCAGAGGTTATATCCAGCCTCTTACCTGGACGCGCGCGACCGACGCTACGGCTTCATCACGGTCGGGTACAAGAGCTCGTGCGCATTCGGGAGGGACACTGATCCCAAAGCCCGCGGAATACCCAAAATCTTCATTTGC
G/T
GAAGAGTCGGTCTGGCGAAAGAAGTTTTCGGCGACGCACTAAACGAGAGCCGGGATCCTGACAGACCGCCGGAGCGTTACACTTCTCAGTTTTACCTGAAGTTTCGCCACCTGGAGCGAGCGTTTGATATGCTCGCGGAGAGCGGGTTCCACATCGTCGCGTGCAATTCATCACTCACCACATCTCCCCACAACAGGCATGCTGATGATAGATACTGGTCCAACAACACAGAGTACGTCTTCTATCGTAAGTACAGCTTATTTACTCTTTACGTTGTATTACAAAAAGAAAGAAAATAAAGCCATTTGGCAATGCTGGGTAGTTACTGATCAGATGAGATGTAATCTGGATTACGTAATCAGATTACAAAATGGAGTACTCGTAGTTAGATTATATTGCTTCTTAATATGAACATAATCAGATTACAGTTACTTTTTATGAATTACATGATTACATAGAGCATTAGTAACCCAACAGCATCCCACTTTTTTCTCTTATCA
(1)
OTHER sa35689 PAGES
ZMP:sa35689 (1)
GENOTYPES No data available

CITATIONS  (1)