ZFIN ID: ZDB-ALT-160325-3
Genomic Feature: el574
Synonyms:
Affected Genomic Regions: irx5a (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN1-irx5a
Lab Of Origin: Crump Lab
Location: Chr 7: 35708614 - 35708626 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 13 bp deleted (1)
FLANKING SEQUENCE (GENOMIC)
AAGTGCAAAACACCATACGTCACCAGCAATTCTCAGTCCATAAGAAGTCAAATTAGAGGAGTTCAAGGTGATTATTATTTAAAGCAATTCTCCCATTATAAATAATATACCACCATTAACCAGCAATCAATTTTGCGCCCGGAGTGGAAACGACTGCGATGAAAAATTGATGATTTTTCCACAGACCTGCCTCTGTGTCTGTGGAGTCTCCCTTGTCCGTGGGCTTGTTTGGCTCGTCGTCGTCGTTTTTCTCTAGATCAATGTTTTCGTCCTCCTCCTCGTCTTCACTCCGGTTCCGTGGGGTCCAGGTCATCTTGTTCTCCTTTTTTAGCCTCCTCCTGGCGTTGGCGAACCAGGTGGACACTTGAGTGAGGGTCATTTTAGTGATGATGGCCAGCATGATCTTCTCGCCTTTGGTGGGGTACGGGTTTTTCCGGTGCTCGTTAAGCCAAGCTTTCAAAGTAGCTGTGGCGTCCCGGGTAGCATTCTTGCGGTAAGCT
GGGTCTCCATACG/-
GGTACGAGCCCAGGGGAGCAGCATAAGGATGATACCCTATAGACCCGGCCATGCCTGTCGTGTGGTCATAAGGTGAGCTCTGCAAAGAGCCAAACCAATTGTTTCATTAGCAAAATATCACTTTGGACACCTGCGCACAATGCAGGATTGCTTTCAAATCGCTTACACAAACACTCAAAAGCCAGCATAAACAAACACACACACTTACGCACACACACATGCATGCCACATGTACACACTTTACGTCTAATTAATCGAAATTGTAAGTACAAGGCCGCGGGGTCACGTATTTTATCGTTTAATTTTGGCTAGATGCCTCATTTCACCCAAAAAGAATGACTGTAAAATACATTTTTACAACTTTCTTTCCAAATCCCCCTTCTTTGTTAATGATCATAAATCTCATTTCGACAGCTTTACTGACTTTTGACTATGTTTATTTTCAGATTAGCCAGCTAATTAGAAGTTACAGCTTTATGTAGGGTCATCTGACAGCGTGT
NOTES
Comment Citation
WT irx5a ... ACCCGTATGGAGACCCAGC

el574 irx5a . ACC - - - - - - - -  ...
ZFIN Staff
OTHER el574 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous irx5ael574/el574 irx5a ♀+/- ♂+/-
Complex irx5ael574/el574 ; irx7el538/el538 ; emx2el586/el586 emx2, irx5a, irx7
irx5ael574/el574 ; irx7el538/el538 irx5a, irx7

CITATIONS  (2)