header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-ALT-151230-5
Genomic Feature: tsu8td
Synonyms:
Affected Genomic Regions: tgfb1a (1)
Type: Small Deletion (1)
Protocol: embryos treated with TALEN1-tgfb1a
Lab Of Origin: Meng Lab
Location: Chr 15: 2803222 - 2803229 (GRCz11) (1) Details
Sequence:
Current Sources: China Zebrafish Resource Center (CZRC)    (order this)
MUTATION DETAILS
DNA/cDNA Change: 8 bp deleted in Exon 1 (1)
Transcript Consequence: Frameshift, Premature Stop (1)
FLANKING SEQUENCE (GENOMIC)
ATCTAGTGATCATCAACATCACATCGTGGGGTATATCAACACGAGTACAATAAGATTCGAATAAATTACACAAGTAGTGAATTGATTGTCTAGGATAGACTTTAAATGAATTGTGCAACCATTTTACATTCCTATCATCATAAAGCAACTCAAACACAGTTACACAATGATTATTGTTCATAATATCTGATGACAGAATGCTGACATAAACATAAACATCGAATACTACAATAAGAAGTAAAAAAAAAAGTACTTTAAATGTCTAACCTTGCTGGAAGACGAACTTATGCACCTCCTTGCCAAAATAGTCCTCATCCTCATCCTGCACAGGGACGATCTTCGTCTTCATTTCTTCGCTCAGTTCAACAGTGCTATTATATAACGAAAGCAAGGAATCCGGGATCTTCTGTCCGTCGTCGTCCGCTCCGGATTCAGGCTCTTTAGCCATGCGCAGTTTACTGAGGATCTGACCCCGAATAGCCTCAATCCGCTTCTTCCTC
ACCACCTC/-
CAAATCCAGAGTCTTACAGGTGGACATGCTGCCCGTTCCCGTGACCAAACACAGGGCGGTCAGCACCAAGCAAACCAACCTCATAATGCTGAAATGTACGACCAAACTGTCCAGCGAGCAAGGAAAAAATGAAATGGAAAGGATCGAAAAGCGTCTGATTATAGAGGTGATGCTACCTGTTGAGGAGTCTGGAAAACACCTTGAATAATGGACTCAGCAGAACAGATGATGTCCGTCAATATGGGAATTTCCTAAGACCTCCATCCAGACAGAAACTAGCTTACAAGCAATTATTAGGCAAGCGCGTATATGAATAGACAGATATGGGATGAAGCCATACACAAATATGAATTCACCACACATGCATCACTGCTGGCAGTCGCACAAATGAATCATTATTCGATCTACACGGCCTGTTTTTCTTTCTATTTTAGGGTTTGGATAGTTGTGAAAACACAGAGACGCGACTGTAAGTGTGTTTACTTGCTAACTTTTCCTCT
NOTES
Comment Citation
Xing et al (2015): 8bp deletion in exon 1, leads to a shift of the open reading  ... Xing et al., 2015
OTHER tsu8td PAGES No links to external sites
GENOTYPES No data available

CITATIONS  (1)