Community Action Needed: Please respond to the NIH RFI
Genomic Feature

tsu8td

ID
ZDB-ALT-151230-5
Name
tsu8td
Synonyms
None
Affected Genomic Region
Construct
None
Type
Allele with one deletion (1)
Protocol
embryos treated with
Lab of Origin
Meng Lab
Current Source
China Zebrafish Resource Center (CZRC)    (order this)
Other Pages
Note
Xing et al (2015): 8bp deletion in exon 1, leads to a shift of the open reading frame with a premature stop codon
Genome Browser
>
Variants
Variant Type
Small Deletion
Variant Location
Chr 15: 2803222 - 2803229 (GRCz11) (1) Details
Nucleotide change
ACCACCTC/-
Variant Notes
Xing et al (2015): 8bp deletion in exon 1, leads to a shift of the open reading  ...
Effect on DNA/cDNA, transcript, protein (from publications)
DNA/cDNA Change
8 bp deleted in Exon 1 (1)
Transcript Consequence
Frameshift, Premature Stop (1)
Protein Consequence
None
Sequences
Flanking Sequence
ATCTAGTGATCATCAACATCACATCGTGGGGTATATCAACACGAGTACAATAAGATTCGAATAAATTACACAAGTAGTGAATTGATTGTCTAGGATAGACTTTAAATGAATTGTGCAACCATTTTACATTCCTATCATCATAAAGCAACTCAAACACAGTTACACAATGATTATTGTTCATAATATCTGATGACAGAATGCTGACATAAACATAAACATCGAATACTACAATAAGAAGTAAAAAAAAAAGTACTTTAAATGTCTAACCTTGCTGGAAGACGAACTTATGCACCTCCTTGCCAAAATAGTCCTCATCCTCATCCTGCACAGGGACGATCTTCGTCTTCATTTCTTCGCTCAGTTCAACAGTGCTATTATATAACGAAAGCAAGGAATCCGGGATCTTCTGTCCGTCGTCGTCCGCTCCGGATTCAGGCTCTTTAGCCATGCGCAGTTTACTGAGGATCTGACCCCGAATAGCCTCAATCCGCTTCTTCCTC
ACCACCTC/- CAAATCCAGAGTCTTACAGGTGGACATGCTGCCCGTTCCCGTGACCAAACACAGGGCGGTCAGCACCAAGCAAACCAACCTCATAATGCTGAAATGTACGACCAAACTGTCCAGCGAGCAAGGAAAAAATGAAATGGAAAGGATCGAAAAGCGTCTGATTATAGAGGTGATGCTACCTGTTGAGGAGTCTGGAAAACACCTTGAATAATGGACTCAGCAGAACAGATGATGTCCGTCAATATGGGAATTTCCTAAGACCTCCATCCAGACAGAAACTAGCTTACAAGCAATTATTAGGCAAGCGCGTATATGAATAGACAGATATGGGATGAAGCCATACACAAATATGAATTCACCACACATGCATCACTGCTGGCAGTCGCACAAATGAATCATTATTCGATCTACACGGCCTGTTTTTCTTTCTATTTTAGGGTTTGGATAGTTGTGAAAACACAGAGACGCGACTGTAAGTGTGTTTACTTGCTAACTTTTCCTCT
Additional Sequence
None
Fish
Supplemental Information
Genotyping protocol
None
Citations