ZFIN ID: ZDB-ALT-151223-1
Genomic Feature: uab1
Synonyms:
Affected Genomic Regions: esco2 (1)
Type: Insertion (1)
Protocol: embryos treated with CRISPR1-esco2
Lab Of Origin: Parant Lab
Location: Chr 20: 39346210 - 39346211 (GRCz11) (1) Details
Sequence:
Current Sources:
MUTATION DETAILS
DNA/cDNA Change: 13 bp inserted (1)
FLANKING SEQUENCE (GENOMIC)
TATATATTTTTTTTTTTCAGACTTTTAAAAAAAAATATATATATATTTTAAAAAACAAGTCTAAAACATGTTTCTACGTATGCATTCTGATCATTCTACGACAAAGAGATTAGCAAAATAATCTGTTTTCTTTTTATATACTGATACATCTGAAAATGTTTTCTCATTTTAGGTGATTGAAGATGTTATCCCGAAAGAGAAAACATGGCTCTCCTGATGCCGAGAGGTAACATTGTGTAGTTTACTTTTATTAGATATTAAAATATTTGCTCTTGTAACACAAATATAAATTTTTTAAAACCCCACCACAGTAATCCATCGAAGAAACAAATAACAAGCCTGAGGAGTTCTCCAAGAAGGACCACTCGACAAAAAGAAAACATTCCCATTTCTCTGAATTCCCCCCAAAAGATTCCCAGCACACCTAAAAAGACGCAGAGGGCCTTTTTGCTAGAATCTCCCCCAAAGCGAGTCTCGCCACGGAAAGCAGTGCTGGGAGCA
-/GAGGGGACCTCTC
GGGACCTTCTACAGCAAGCAGAAACCCCTGTATCTCACACCTCTGGAGAGAAAAGTGCTGAAAGAAGCCAAATCTCCACCATCAGTCACTAACAAAGAGCCGTCACGCCCTCCTTTGACTGCTGCGAATCAGGTTGTAAAACCAGCCAAGAAAGTTCAGAAGAAACCCAGAGCTTCTGCTCCACAGTCCAACCTAAAAGGCTACTTCACGGCTAAGCCCAAAGCGACAAAAAGTTCGTCAGATAAACAAACGGATCAAGTGCTGAAATCCACAATGGCTCCCATTTCATTCAGCAGTATGAAGTCCAAAGGTAAACCCAAGCTGGTTGTCGGCGCTGCTTTCTTCAACACTGGAAAAAAGCCTACTTCAATGTATAAGAAGTCTGCACAGAATACAAAACCTAAACCAACATACGAAAAACCCAGCATTCGGAAACCGGTGAGGGAGAAGGAATTGGTGACGGCACCAGGACAGCGTTCCCCAGTTCGCCGTGCTGTTTTC
Comment Citation
Percival et al (2015) 13 bp insertion occurs in the second ATG containing exon  ... Percival et al., 2015
OTHER uab1 PAGES No links to external sites
GENOTYPES
Zygosity Genotype (Background) Affected Genomic Regions Parental Zygosity
Homozygous esco2uab1/uab1 esco2 ♀+/- ♂+/-

CITATIONS  (1)